View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_low_78 (Length: 274)
Name: NF2014_low_78
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_low_78 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 148 - 238
Target Start/End: Complemental strand, 506546 - 506456
Alignment:
| Q |
148 |
attggtggaagatgatcctccatggctgagatccattatctgtttgtccataaacgatgtcgtattcattgatcaatcaaaagcttctgag |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
506546 |
attggtggaagatgatcctccatggctgagatccattatctgtttgtccataaacgatgtcgtattcattgatcaatcaaaagcttctgag |
506456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 13 - 67
Target Start/End: Complemental strand, 506678 - 506624
Alignment:
| Q |
13 |
aatatcatcggttttgattcctccaccatttttgtgatgaattaacgaatcatta |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
506678 |
aatatcatcggttttgattcctccaccatttttgtgatgaattaacgaatcatta |
506624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University