View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2014_low_89 (Length: 251)
Name: NF2014_low_89
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2014_low_89 |
 | |
|
| [»] chr3 (5 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 33594024 - 33594264
Alignment:
| Q |
11 |
cacagacacaggagaaggttgaaaatggcaggtggggggtttgccattgatgcaccttccaatggctttgatggaaagataacactctcagttatcatta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33594024 |
cacagacacaggagaaggttgaaaatggcaggtggagggtttgccattgatgcaccttccaatggctttgatggaaagataacactctcagttatcatta |
33594123 |
T |
|
| Q |
111 |
cttgtatcgttgctgcatctagtggactcatttttggatatgacattgggatttcaggttttcttccnnnnnnnnnnnncattataaagtatccaattag |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33594124 |
cttgtatcgttgctgcatctagtggactcatttttggatatgacattgggatttcaggttttcttcctttttgttttttcattataaagtatccaattag |
33594223 |
T |
|
| Q |
211 |
accatgttttttgctttctaaagtatcttgtattctgctac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33594224 |
accatgttttttgctttctaaagtatcttgtattctgctac |
33594264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 33601155 - 33601395
Alignment:
| Q |
11 |
cacagacacaggagaaggttgaaaatggcaggtggggggtttgccattgatgcaccttccaatggctttgatggaaagataacactctcagttatcatta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33601155 |
cacagacacaggagaaggttgaaaatggcaggtggagggtttgccattgatgcaccttccaatggctttgatggaaagataacactctcagttatcatta |
33601254 |
T |
|
| Q |
111 |
cttgtatcgttgctgcatctagtggactcatttttggatatgacattgggatttcaggttttcttccnnnnnnnnnnnncattataaagtatccaattag |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33601255 |
cttgtatcgttgctgcatctagtggactcatttttggatatgacattgggatttcaggttttcttcctttttgttttttcattataaagtatccaattag |
33601354 |
T |
|
| Q |
211 |
accatgttttttgctttctaaagtatcttgtattctgctac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33601355 |
accatgttttttgctttctaaagtatcttgtattctgctac |
33601395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 20 - 251
Target Start/End: Original strand, 33586861 - 33587092
Alignment:
| Q |
20 |
aggagaaggttgaaaatggcaggtggggggtttgccattgatgcaccttccaatggctttgatggaaagataacactctcagttatcattacttgtatcg |
119 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||| |||||||| || ||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
33586861 |
aggacaaggttgaaaatggcaggtgggggatttgccattgatgcaccttcgaatggcttcgacggaaatataacactctcggttatcattacttgtatcg |
33586960 |
T |
|
| Q |
120 |
ttgctgcatctagtggactcatttttggatatgacattgggatttcaggttttcttccnnnnnnnnnnnncattataaagtatccaattagaccatgttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33586961 |
ttgctgcatctagtggactcatttttggatatgacattgggatttcaggttttcttcctttttgttttttcattataaagtatccaattagaccatgttt |
33587060 |
T |
|
| Q |
220 |
tttgctttctaaagtatcttgtattctgctac |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33587061 |
tttgctttctaaagtatcttgtattctgctac |
33587092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 86 - 172
Target Start/End: Original strand, 33561694 - 33561780
Alignment:
| Q |
86 |
aagataacactctcagttatcattacttgtatcgttgctgcatctagtggactcatttttggatatgacattgggatttcaggtttt |
172 |
Q |
| |
|
|||||||||||||||||| |||| ||||| || ||||| |||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
33561694 |
aagataacactctcagttgtcatcacttgcattgttgcagcatctagtggactcatttttggatatgaccttggaatttcaggtttt |
33561780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 90 - 170
Target Start/End: Original strand, 33607998 - 33608078
Alignment:
| Q |
90 |
taacactctcagttatcattacttgtatcgttgctgcatctagtggactcatttttggatatgacattgggatttcaggtt |
170 |
Q |
| |
|
||||||| ||| | |||||||| || ||||||||||| || ||||| || ||||||||||||||||||| |||||||||| |
|
|
| T |
33607998 |
taacactttcaatcatcattacatgcatcgttgctgcttccagtggtcttctttttggatatgacattggaatttcaggtt |
33608078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University