View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2014_low_99 (Length: 245)

Name: NF2014_low_99
Description: NF2014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2014_low_99
NF2014_low_99
[»] chr1 (2 HSPs)
chr1 (20-234)||(38820537-38820751)
chr1 (23-236)||(38830935-38831148)
[»] chr2 (2 HSPs)
chr2 (125-234)||(28159286-28159395)
chr2 (125-226)||(16081874-16081975)


Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 20 - 234
Target Start/End: Original strand, 38820537 - 38820751
Alignment:
20 attctatggtctttcttacatcctgaaaattataaaggacctaaggttatcgggtttgatatcgagttgtcgatgtgtnnnnnnnnngtatcagaagaag 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||    
38820537 attctatggtctttcttacatcctgaaaattataaaggacctaaggttatcgggtttgatatcgagttgtcgatgtgtgaaaataaagtatcagaagaag 38820636  T
120 aaaccaattttgagaccgaatgtgcaaccttgaatctatgcaatggccattcgtgtcttattattcagttatgtcatttagattcatttcccacatcatt 219  Q
    ||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||    
38820637 aaaccaattttgagaccgaatgtgcaatcttgaatctatgcaatggtcattcgtgtcttattattcagctatgtcatttagattcatttcccacatcatt 38820736  T
220 gcttaatattcttcg 234  Q
    ||||||| |||||||    
38820737 gcttaattttcttcg 38820751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 23 - 236
Target Start/End: Original strand, 38830935 - 38831148
Alignment:
23 ctatggtctttcttacatcctgaaaattataaaggacctaaggttatcgggtttgatatcgagttgtcgatgtgtnnnnnnnnngtatcagaagaagaaa 122  Q
    |||||||| ||||||| ||||| ||||||||| ||||| ||||| |||||||| ||| |||||||||| |||| |         |||||||| |||||||    
38830935 ctatggtccttcttacgtcctgcaaattataatggaccaaaggtaatcgggttcgatgtcgagttgtcaatgtttgaaaataaggtatcagaggaagaaa 38831034  T
123 ccaattttgagaccgaatgtgcaaccttgaatctatgcaatggccattcgtgtcttattattcagttatgtcatttagattcatttcccacatcattgct 222  Q
     | |     |  |||||||||||||  || | ||||| |||||||| | |||||||||||||||| ||||||||||||||||| ||||||||||||||||    
38831035 tctacgacaattccgaatgtgcaactctgcacctatgtaatggccagttgtgtcttattattcagctatgtcatttagattcagttcccacatcattgct 38831134  T
223 taatattcttcgac 236  Q
    |||  |||||||||    
38831135 taactttcttcgac 38831148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 125 - 234
Target Start/End: Original strand, 28159286 - 28159395
Alignment:
125 aattttgagaccgaatgtgcaaccttgaatctatgcaatggccattcgtgtcttattattcagttatgtcatttagattcatttcccacatcattgctta 224  Q
    ||||| |||||||||| ||||||  || ||||||| | |||  |||| |||||||||||||||| |||||||| |||||||||||||||| |||||||||    
28159286 aatttcgagaccgaatatgcaactctgcatctatgtattggttattcatgtcttattattcagtcatgtcattaagattcatttcccacaacattgctta 28159385  T
225 atattcttcg 234  Q
    || |||||||    
28159386 attttcttcg 28159395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 125 - 226
Target Start/End: Original strand, 16081874 - 16081975
Alignment:
125 aattttgagaccgaatgtgcaaccttgaatctatgcaatggccattcgtgtcttattattcagttatgtcatttagattcatttcccacatcattgctta 224  Q
    ||||| |||||||||| ||||||  || ||||||| | |||  ||| ||| |||||||||||||||||||||| ||||||||||||||||||||| ||||    
16081874 aatttcgagaccgaatatgcaactctgcatctatgtattggttatttgtgacttattattcagttatgtcattaagattcatttcccacatcattactta 16081973  T
225 at 226  Q
    ||    
16081974 at 16081975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University