View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20150_high_11 (Length: 226)
Name: NF20150_high_11
Description: NF20150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20150_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 209
Target Start/End: Complemental strand, 39484143 - 39483949
Alignment:
| Q |
15 |
caaaggtcgaatgtcgttgttttctacagaatttccccatttggtttctcttatggcgcaaaaatcaatttagctacgcggtgttctcacatgtgttcgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39484143 |
caaaggtcgaatgtcgttgttttctacagaatttccccatttggtttctcttatggcgcaaaaatcaatttagctacgcggtgttctcacatgtgttcgg |
39484044 |
T |
 |
| Q |
115 |
atgtcattgttatctggacttcagtctaccgctgcagctattgtatgatgggatttatgtcaattgttgaggtgataaactactgtatctagatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39484043 |
atgtcattgttatctggacttcagtctactgttgcagctattgtatgatgggatttatgtcaattgttgaggtgataaactactgtatctagatg |
39483949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 164 - 209
Target Start/End: Original strand, 6668785 - 6668830
Alignment:
| Q |
164 |
gggatttatgtcaattgttgaggtgataaactactgtatctagatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
6668785 |
gggatttatgtcaattgttgaggtgatgaactcatgtatctagatg |
6668830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University