View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20150_low_13 (Length: 246)
Name: NF20150_low_13
Description: NF20150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20150_low_13 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 51 - 246
Target Start/End: Complemental strand, 12250796 - 12250606
Alignment:
| Q |
51 |
ctcaccaagcaaaactgaagtttgttttagaaaacattgtattttcaatttagttagctataaatatttaccttgctttcgttagcatttcatttcatcc |
150 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||| ||||||||| ||||||||||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
12250796 |
ctcaccaagcaaaactgaattttgttttagaaaatattgtattctcaatttag----ctataaatatttaccttgcattccttagcatt-catttcatcc |
12250702 |
T |
|
| Q |
151 |
acacttgcttttctattggttttctttccgttaaaccatttacactttccacaaaatcattcatggcgtgggttcttctgtttttgcatatttttc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12250701 |
acacttgcttttctattggttttctttcagttaaaccatttacactttccacaaaatcattcatggcgtgggttcttctgtttttgcatatttttc |
12250606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 141 - 246
Target Start/End: Complemental strand, 11120715 - 11120607
Alignment:
| Q |
141 |
catttcatccacacttgcttttctattggttttctt---tccgttaaaccatttacactttccacaaaatcattcatggcgtgggttcttctgtttttgc |
237 |
Q |
| |
|
|||||||||||||||| |||||||| | ||||||| || ||||||||| |||| |||| ||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
11120715 |
catttcatccacacttatttttctatagcttttcttctttcatttaaaccatatacagtttctacaaaatcattcatggcatggtttcttctgtttttgc |
11120616 |
T |
|
| Q |
238 |
atatttttc |
246 |
Q |
| |
|
|| |||||| |
|
|
| T |
11120615 |
atctttttc |
11120607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 246
Target Start/End: Complemental strand, 42131090 - 42131052
Alignment:
| Q |
208 |
cattcatggcgtgggttcttctgtttttgcatatttttc |
246 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
42131090 |
cattcatggcgtggtttcttctgtttttgcatctttttc |
42131052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University