View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20150_low_16 (Length: 215)
Name: NF20150_low_16
Description: NF20150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20150_low_16 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 107 - 215
Target Start/End: Original strand, 43368729 - 43368837
Alignment:
| Q |
107 |
gtgtaaatttgaggtctcacacagtttatctacttccgaactttggtgtttgatgttgttatgaccgacgttaaccttcacattcttcttatgctggcct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43368729 |
gtgtaaatttgaggtctcacacagtttatctacttccgaactttggtgtttgatgttgttatgaccgacgttaaccttcacattctttttatgctggcct |
43368828 |
T |
|
| Q |
207 |
tttttcttc |
215 |
Q |
| |
|
||||||||| |
|
|
| T |
43368829 |
tttttcttc |
43368837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 14 - 47
Target Start/End: Original strand, 43368624 - 43368657
Alignment:
| Q |
14 |
ttctacttccctattcatttttgcttttaaagcc |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43368624 |
ttctacttccctattcatttttgcttttaaagcc |
43368657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University