View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_high_103 (Length: 286)
Name: NF20151_high_103
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_high_103 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 39266407 - 39266203
Alignment:
| Q |
16 |
ctttccttcgtcgatcttcatcgaagccatcaatcaccgcctcaacaccgaggttaacctcccaatctcgcgtttcaccttatggctacctcctaaaccg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39266407 |
ctttccttcgtcgatcttcatcgaagccatcaatcaccgcctcaacaacgaggttaacctcccaatctcgcgtttcaccttatggctacctcctaaaccg |
39266308 |
T |
 |
| Q |
116 |
cgtcgctggttatgcaatcgaggccgccgccgcacctgctccgtctgcgtttccggaaaaggaggaggtttccagagatggtaaaatcactattgaatga |
215 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
39266307 |
cgtcgctgattatgcaatcgtggccgccgccgcacctgctccgtttgcgtttccggcaaaggaggaggtttccagagatggtaaaatcactattgattga |
39266208 |
T |
 |
| Q |
216 |
gtttt |
220 |
Q |
| |
|
||||| |
|
|
| T |
39266207 |
gtttt |
39266203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 216 - 261
Target Start/End: Complemental strand, 39266172 - 39266128
Alignment:
| Q |
216 |
gtttttaatgtttgtgagatttgattttgagatcattttggtttga |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39266172 |
gtttttaatgtttgtgagatttgattttga-atcattttggtttga |
39266128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 49156652 - 49156470
Alignment:
| Q |
20 |
ccttcgtcgatcttcatcgaagccatcaatcaccgcctcaacaccgaggttaacctcccaatctcgcgtttcaccttatggctacctcctaaaccgcgtc |
119 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| ||||||||| ||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
49156652 |
ccttcgccgatcttcatcgaaaccatcaatcactgcctcaacatcgaggctaacctcccaatctcgcgcttcaccttatggctacctcttaaaccgcgtc |
49156553 |
T |
 |
| Q |
120 |
gctggttatgcaatcgaggccgccgccgcacctgctccgtctgcgtttccggaaaaggaggaggtttccagagatggtaaaat |
202 |
Q |
| |
|
|||| |||||||| || ||| ||||||||||| |||||||||||| ||||| ||| |||||||| || ||| ||| ||||| |
|
|
| T |
49156552 |
gctgattatgcaaccgcggctgccgccgcaccagctccgtctgcgcctccggcgaagaaggaggttcccggaggtgggaaaat |
49156470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 214 - 281
Target Start/End: Complemental strand, 49156159 - 49156093
Alignment:
| Q |
214 |
gagtttttaatgtttgtgagatttgattttgagatcattttggtttgaatctttatgttacgtttcat |
281 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||||| ||||||||| |||| ||| |||||||| |
|
|
| T |
49156159 |
gagtttttactgtttgtgagatctgattttgaaatcattgcggtttgaat-tttaagttgcgtttcat |
49156093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University