View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20151_high_123 (Length: 253)

Name: NF20151_high_123
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20151_high_123
NF20151_high_123
[»] chr4 (1 HSPs)
chr4 (14-235)||(15639896-15640117)
[»] chr7 (3 HSPs)
chr7 (98-170)||(19258241-19258313)
chr7 (167-206)||(18702553-18702592)
chr7 (167-206)||(26423679-26423718)
[»] chr5 (2 HSPs)
chr5 (167-205)||(7968275-7968313)
chr5 (177-206)||(27111498-27111527)
[»] chr8 (1 HSPs)
chr8 (167-204)||(27428091-27428128)
[»] chr3 (2 HSPs)
chr3 (173-206)||(34545470-34545503)
chr3 (167-199)||(32925134-32925166)


Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 235
Target Start/End: Complemental strand, 15640117 - 15639896
Alignment:
14 agatggattcggagtctagtttaggtccatatgagggtttgccttttccttctgcacttcttcacttttctgcatcttggatgtcaaggaatgaaagtga 113  Q
    |||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||     
15640117 agatggattcggagtctagtttaggtccagctgagggtttgccttttccttctgcacttcttcacttttctgcattttggatgtcaaggaatgaaagtgg 15640018  T
114 aaaattagggttgtgactggtcactacatcggtaaggattgtgctatgccacctgtcctttattaggacgtagtttttctttgcttctttttcccctctc 213  Q
    |||||||||||||||||||| ||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15640017 aaaattagggttgtgactggacaccacatcggtgaggattgcgctatgccacctgtcctttattaggacgtagtttttctttgcttctttttcccctctc 15639918  T
214 ttgtaaccaaaaaagtcggagg 235  Q
     |||||||||||||||||||||    
15639917 atgtaaccaaaaaagtcggagg 15639896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 98 - 170
Target Start/End: Complemental strand, 19258313 - 19258241
Alignment:
98 caaggaatgaaagtgaaaaattagggttgtgactggtcactacatcggtaaggattgtgctatgccacctgtc 170  Q
    ||||||| ||||||| |||||||||||||||||||| ||| |||||||| |||||||  |||||||| |||||    
19258313 caaggaaagaaagtggaaaattagggttgtgactggacaccacatcggtgaggattgcactatgccatctgtc 19258241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 206
Target Start/End: Complemental strand, 18702592 - 18702553
Alignment:
167 tgtcctttattaggacgtagtttttctttgcttctttttc 206  Q
    |||||||||||||||||||||||| |||||||||||||||    
18702592 tgtcctttattaggacgtagttttgctttgcttctttttc 18702553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 167 - 206
Target Start/End: Original strand, 26423679 - 26423718
Alignment:
167 tgtcctttattaggacgtagtttttctttgcttctttttc 206  Q
    ||||| ||||||||||||||||||||||||||||||||||    
26423679 tgtccattattaggacgtagtttttctttgcttctttttc 26423718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 205
Target Start/End: Complemental strand, 7968313 - 7968275
Alignment:
167 tgtcctttattaggacgtagtttttctttgcttcttttt 205  Q
    ||||||||||||||||||||||||||||||||| |||||    
7968313 tgtcctttattaggacgtagtttttctttgctttttttt 7968275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 177 - 206
Target Start/End: Original strand, 27111498 - 27111527
Alignment:
177 taggacgtagtttttctttgcttctttttc 206  Q
    ||||||||||||||||||||||||||||||    
27111498 taggacgtagtttttctttgcttctttttc 27111527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 27428128 - 27428091
Alignment:
167 tgtcctttattaggacgtagtttttctttgcttctttt 204  Q
    ||||||||||||||||||||||||||||||||| ||||    
27428128 tgtcctttattaggacgtagtttttctttgcttttttt 27428091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 173 - 206
Target Start/End: Complemental strand, 34545503 - 34545470
Alignment:
173 ttattaggacgtagtttttctttgcttctttttc 206  Q
    ||||||||||||||||||||||| ||||||||||    
34545503 ttattaggacgtagtttttctttacttctttttc 34545470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 167 - 199
Target Start/End: Complemental strand, 32925166 - 32925134
Alignment:
167 tgtcctttattaggacgtagtttttctttgctt 199  Q
    |||||||||||||||| ||||||||||||||||    
32925166 tgtcctttattaggacatagtttttctttgctt 32925134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University