View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_high_137 (Length: 247)
Name: NF20151_high_137
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_high_137 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 9699333 - 9699117
Alignment:
| Q |
18 |
gggatttactctggcgattaattctcatgatcggtgctgttccagctgcgatgacttactactggagaatgaaaatgcctgaaaccggtcgttacactgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699333 |
gggatttactctggcgattaattctcatgatcggtgctgttccagctgcgatgacttactactggagaatgaaaatgcctgaaaccggtcgttacactgc |
9699234 |
T |
|
| Q |
118 |
aatcgtagaagggaacgcgaaacaagccgctgcagacatggcaagagttttggacatcgaaatcatagcggagcaagataagttggctgaatttaaagca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699233 |
aatcgtagaagggaacgcgaaacaagccgctgcagacatggcaagagttttggacatcgaaatcatagcggagcaagataagttggctgaatttaaagca |
9699134 |
T |
|
| Q |
218 |
gcaaatgattaccctct |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9699133 |
gcaaatgattaccctct |
9699117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 38 - 114
Target Start/End: Complemental strand, 16174929 - 16174853
Alignment:
| Q |
38 |
attctcatgatcggtgctgttccagctgcgatgacttactactggagaatgaaaatgcctgaaaccggtcgttacac |
114 |
Q |
| |
|
||||| ||| |||||||| |||||||||| |||| ||||||||| ||||||||||||| ||||| | ||||||||| |
|
|
| T |
16174929 |
attcttatgttcggtgctcttccagctgcattgacgtactactggcgaatgaaaatgccagaaacagctcgttacac |
16174853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 38 - 114
Target Start/End: Original strand, 16223823 - 16223899
Alignment:
| Q |
38 |
attctcatgatcggtgctgttccagctgcgatgacttactactggagaatgaaaatgcctgaaaccggtcgttacac |
114 |
Q |
| |
|
||||| ||| |||||||| |||||||||| |||| ||||||||| ||||||||||||| ||||| | ||||||||| |
|
|
| T |
16223823 |
attcttatgttcggtgctcttccagctgcattgacgtactactggcgaatgaaaatgccagaaacagctcgttacac |
16223899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University