View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_high_164 (Length: 218)
Name: NF20151_high_164
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_high_164 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-100; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 2034395 - 2034582
Alignment:
| Q |
18 |
actagtttatcaaatctcttgcattttcaacttggtttcaagcatatagccggcgttatattccataatccatcttatttgaggtgttatgtattgcgtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2034395 |
actagtttatcaaatctcttgcattttcaacttggtttcaagcatatagccggcgttatattccataatccatcttatttgaggtgttatgtattgcgtg |
2034494 |
T |
 |
| Q |
118 |
ccttttattattgcttactttactatttgactagttccaagtaagctatatccctcaaactgataggaattgatgtctttaatctctg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2034495 |
ccttttattattgcttactttactatttgactagttccaagtaagctatatccctcaaactgataggaattggtgtctttaatctctg |
2034582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 34 - 67
Target Start/End: Original strand, 2058618 - 2058651
Alignment:
| Q |
34 |
tcttgcattttcaacttggtttcaagcatatagc |
67 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
2058618 |
tcttgcatttttaacttggtttcaagcatatagc |
2058651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 67
Target Start/End: Original strand, 2051147 - 2051187
Alignment:
| Q |
27 |
tcaaatctcttgcattttcaacttggtttcaagcatatagc |
67 |
Q |
| |
|
|||| |||| |||||||||||||||| |||||||||||||| |
|
|
| T |
2051147 |
tcaagtctcctgcattttcaacttggcttcaagcatatagc |
2051187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 17183047 - 17183007
Alignment:
| Q |
18 |
actagtttatcaaatctcttgcattttcaacttggtttcaa |
58 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17183047 |
actagttaatcaaatctcttgcattttcaacttggtttcaa |
17183007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University