View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20151_high_170 (Length: 206)

Name: NF20151_high_170
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20151_high_170
NF20151_high_170
[»] chr3 (1 HSPs)
chr3 (14-190)||(5851980-5852156)


Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 190
Target Start/End: Original strand, 5851980 - 5852156
Alignment:
14 attatactgataaacaaaatatttgcacaacttagtccaagtcttcttgtgtgataattgatgaaaaatcaaaacagttttgtggtatataatctagtct 113  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5851980 attatactgataaacaaaatattggcacaacttagtccaagtcttcttgtgtgataattgatgaaaaatcaaaacagttttgtggtatataatctagtct 5852079  T
114 actcagcttaaagctttggtttgttgacaagatgtgaacggataaattgacaattagcagcaccactaaggtaatgg 190  Q
    |||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||    
5852080 actcagcttaaagctttggtttgttagcaagatgtgaacggataaattgacaattagcagcaccactaaggtaatgg 5852156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University