View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_high_30 (Length: 457)
Name: NF20151_high_30
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 207 - 440
Target Start/End: Original strand, 915934 - 916167
Alignment:
| Q |
207 |
ggtaattaaacatttatttcaaccataccaaaaacggagtgatggtgtgtcctattccaacctttccaatctcctctgttttttattcaccacctacttg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
915934 |
ggtaattaaacatttatttcaaccataccaaaaacggagtgatggtgtgtcctattccaacctttccaatctcctctgttttttattcaccacctacttg |
916033 |
T |
 |
| Q |
307 |
ggaagttgaagttgacctcgtactgtgtttgtttgatgaagacaactcagttgaccttctcctgagtatctgtctcataccatcagcaacacaaactgca |
406 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
916034 |
ggaagtggaagttgacctcgtactgtgtttgtttgatgaagacaactcagttgaccttctcctgagtatctgtctcataccatcagcaacacaaactgca |
916133 |
T |
 |
| Q |
407 |
ggatttgatttaatcttgcgacagaacaacatgt |
440 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
916134 |
ggatttgatttaatcttacgacagaacaacatgt |
916167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 13 - 73
Target Start/End: Original strand, 915749 - 915809
Alignment:
| Q |
13 |
gagagagaatggttattgatcattttcatgcagaataaaattgggattcacttctgttgcc |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
915749 |
gagagagaatggttattgatcattttcatgcagaatataattgggattcacttctgttgcc |
915809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University