View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_high_95 (Length: 294)
Name: NF20151_high_95
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_high_95 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 7e-49; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 165 - 279
Target Start/End: Complemental strand, 12116249 - 12116135
Alignment:
| Q |
165 |
tgtaaatatagaaaagacagtgactcagctcaatttagattagtcaatgtccaacataactttccgatatttgtacagacaaaaatatttctttctgatt |
264 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12116249 |
tgtaaatataaaaaagacagcgagtcagctcaatttagattagtcaatatccaacataactttccgatatttgtacagacaaaaatatttctttctgatt |
12116150 |
T |
 |
| Q |
265 |
ttcatggttgatgtt |
279 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
12116149 |
ttcatggttgatgtt |
12116135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 12 - 63
Target Start/End: Complemental strand, 12116600 - 12116549
Alignment:
| Q |
12 |
aatcgaaccgaactgtttttgttcaattccagaattgttcctaatgattcaa |
63 |
Q |
| |
|
|||| |||||||||||||| ||||| ||||||||||||| |||||||||||| |
|
|
| T |
12116600 |
aatcaaaccgaactgttttagttcagttccagaattgttactaatgattcaa |
12116549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 126 - 168
Target Start/End: Complemental strand, 12116458 - 12116416
Alignment:
| Q |
126 |
cagtttggtttcaatgtgtaatgaattgaatttgagttttgta |
168 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
12116458 |
cagtttggtttcaacgtgtaatgatttgaatttgagttttgta |
12116416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University