View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_high_98 (Length: 287)
Name: NF20151_high_98
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_high_98 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 3 - 276
Target Start/End: Complemental strand, 13793499 - 13793226
Alignment:
| Q |
3 |
taatttgattactgttcctatgtatacatgatagtattggaagtcttggaaagtatccggatgagatagaggtgagtggcattagagtgcagacctgcaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13793499 |
taatttgattactgttcctatgtatacatgatagtattggaagtcttggaaagtatccggatgagatagaggtgagtggcattagagtgcagacctgcaa |
13793400 |
T |
|
| Q |
103 |
attagttggcacaaccaatggcctcagaatcaaatcatggccagataagtatcctggtgcagcaacagatatcaagtacagtgacattacaatggaaaat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13793399 |
attagttggcacaaccaatggcctcagaatcaaatcatggccagataagtatcctggtgcagcaacagatatcaactacagtgacattacaatggaaaat |
13793300 |
T |
|
| Q |
203 |
gttaagaatcctatcatcattgaccaagagtatgaatgctctccaaattgcaaaaagaaggtttgtgtgttcat |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13793299 |
gttaagaatcctatcatcattgaccaagagtatgaatgctctccaaattgcaaaaagaaggtttgtgtgttcat |
13793226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University