View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_104 (Length: 298)
Name: NF20151_low_104
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_104 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 37 - 282
Target Start/End: Complemental strand, 37661406 - 37661164
Alignment:
| Q |
37 |
atgaatttccgaaattgatcgaacacatttcatatnnnnnnnnnnngcattttgcagcaaatagacttaaaaagcatgtggaacttttattgtttcagtt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37661406 |
atgaatttccgaaattgatcgaacacatttcatatcaaaaaaa---gcattttacaccaaatagacttaaaaagcatgtggaacttttattgtttcagtt |
37661310 |
T |
 |
| Q |
137 |
tccttttcaaggttacttgattcattgctgtgttaaattccgcagctttcaactagtcaaagctgcaattagactatcgacgttgcactgagagggtgag |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37661309 |
tccttttcaaggttacttgattcattgctgtgttaaattccgcagctttcaactagtcaaagctgcaattagactatcgacattgcactgagagggtgag |
37661210 |
T |
 |
| Q |
237 |
agggatagtgactctgtgagtgaccatagtacacatcttttttact |
282 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37661209 |
agggatagtgactgtgtgagtgaccatagtacacatcttttttact |
37661164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University