View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_115 (Length: 285)
Name: NF20151_low_115
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_115 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 9e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 8 - 132
Target Start/End: Complemental strand, 42415521 - 42415396
Alignment:
| Q |
8 |
agagagaagaatgcaatgttctcatatagttttttattgnnnnnnnnnnn-atgaatcattttttattggatataaagtgagagaagggaaaatggatat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
42415521 |
agagagaagaatgcaatgttctcatatagttttttattgttttttttttttatgaatcattttttattggatataaagtgagagaagggaaaatgaatct |
42415422 |
T |
|
| Q |
107 |
ttggaatatgaaaaacaaccctatgt |
132 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42415421 |
ttggaatatgaaaaacaaccctatgt |
42415396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 199 - 272
Target Start/End: Complemental strand, 42415329 - 42415256
Alignment:
| Q |
199 |
ccttcattcacaaaccaatataaagtaaactatattaatatatttaaatgtacaaattttatccaatgatttca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42415329 |
ccttcattcacaaaccaatataaagtaaactatattaatatatttaaatgtacaaattttatccaatgatttca |
42415256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University