View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_119 (Length: 278)
Name: NF20151_low_119
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_119 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 54981886 - 54982078
Alignment:
| Q |
18 |
atataaatgagagatacatgatattggggtaactttttcacttttaagtactccttaaacatgtatattctagaatgagacaatacaatttagtatattt |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54981886 |
atataaatgagagatacatgatattagggtaactttttcacttttaagtac------aacatgtatattctagaatgagacaatacaatttagtatattt |
54981979 |
T |
|
| Q |
118 |
tggagtataaccttaaatatatttgactttaaaagtgttttattgtcc-----acgttattcaaaaagataaaaatttaagtatatttttgttatgttg |
211 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
54981980 |
tggagtataaccgtaaatatatttgcctttaaaagtgttttattgtccacggtacgttattcaaaaagataagattttaagtatatttttgttatgttg |
54982078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University