View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_123 (Length: 274)
Name: NF20151_low_123
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_123 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 38 - 259
Target Start/End: Original strand, 1905434 - 1905650
Alignment:
| Q |
38 |
gaaggcttgggattcattgccaaactatcttggcatggcatcttcatttttgcgttggttgtcgcatatcacttggtcatagctgaccccaaatatgaag |
137 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1905434 |
gaaggcttgggattcatggccaaactatcttggcat-----cttcatttttgcgttggttgtcgcatatcacttggtcatagctgaccccaaatatgaag |
1905528 |
T |
|
| Q |
138 |
ccaataattagatactatgnnnnnnnggtagtaaaggtactagatggctcattcccccaatcaaaggattaaggatagctaaaacgcaagtaaattaatg |
237 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1905529 |
ccaataattagatactatgaaaaaaaggtagtaaaggtactagatggctcattcccccaatcaaaggattaaggatagctaaaacgcaagtaaattaatg |
1905628 |
T |
|
| Q |
238 |
cttgttcccggaccaatatttt |
259 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1905629 |
cttgttcccggaccaatatttt |
1905650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University