View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_149 (Length: 249)
Name: NF20151_low_149
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_149 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 15 - 235
Target Start/End: Original strand, 7475869 - 7476089
Alignment:
| Q |
15 |
catcaccccctccccaacatacacccccaatcactctctctcctcgtcctcattgcatgagcacagttttcttaatataagtttgcagagatgattgggg |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7475869 |
catctccccctccccaacatacacccccaatcactatctctcctcatcctcattgcatgagcacagttttcttaatataagtttgcagagatgattgggg |
7475968 |
T |
 |
| Q |
115 |
aatatttaaaccccgatcctatatttgcagaaaccaaacatatatttaaccttttgatatactttgnnnnnnntaatcaataaattgtagacttagttca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7475969 |
aatatttaaaccccgatcctatatttgcagaaaccaaacatatatttaaccttttgatatactttgaaaaaaataatcaataaattgtagacttagttca |
7476068 |
T |
 |
| Q |
215 |
aacagtcacatactcacaggt |
235 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
7476069 |
accagtcacatactcacaggt |
7476089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University