View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_151 (Length: 247)
Name: NF20151_low_151
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_151 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 225
Target Start/End: Original strand, 32483758 - 32483970
Alignment:
| Q |
13 |
tagattattctagaatattaattgcctgctatagctatagcataaatttttgcattctgttgtattgtcaaggttaactaattaacatagtcaaataata |
112 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
32483758 |
tagattattctagaatattaattgcttgctatagctatagcataaatttttgcattctgttgtattgtcgaggttaattaattaacatagtcaaataata |
32483857 |
T |
|
| Q |
113 |
ttatacaatatatgtctaatgacttttttgttttgttaaaaaataaaggcttagaggaagcaaattttcctgctgtggtaagctcaccagcggagttcag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483858 |
ttatacaatatatgtctaatgacttttttgttttgttaaaaaataaaggcttagaggaagcaaattttcctgctgtggtaagctcaccagcggagttcag |
32483957 |
T |
|
| Q |
213 |
gtgtgtaagggtt |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32483958 |
gtgtgtaagggtt |
32483970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University