View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_154 (Length: 243)
Name: NF20151_low_154
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_154 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 2820174 - 2820384
Alignment:
| Q |
18 |
aggctagaatgtatttctcactcacagaccacgcgtatccttcaatataaactttgtatctgatatcaaggaaaatcaaatacatatatatacatattat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2820174 |
aggctagaatgtatttctcactcacagaccacgcgtatccttcaatataaactttgtatctgatatcaaggaaaatcaaatacatacatatacatattat |
2820273 |
T |
 |
| Q |
118 |
attaatttaaatgtacatgatgaattttgggataaaaaataaaacatatgtgatctgagattaaatggaactacctatatgtacattggtctgccaagtt |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2820274 |
attaatttaaatgtagatgatgaattttgggataaaaaataaaacatatgtgatctgagattaaatggaactacctatatgtacattggtctgccaagtt |
2820373 |
T |
 |
| Q |
218 |
tgagtgattga |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
2820374 |
tgagtgattga |
2820384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University