View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_156 (Length: 242)
Name: NF20151_low_156
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_156 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 32206952 - 32206728
Alignment:
| Q |
1 |
aagtcaaagtttgtccctgtgaatgcttgtatccaaattgttgctattagcaccacccactttcttgattctccaaccatttttgttcttccctcttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32206952 |
aagtcaaagtttgtccctgtgaatgcttgtatccaaattgttgctattagcaccacccactttcttgattctccaaccatttttcttcttccctcttgaa |
32206853 |
T |
 |
| Q |
101 |
gatttcctccaattccttcttccaaccaccaagaaaataggtgatgtattatatcagcttttcttttctgttcaaggtgaatttgatgatggcttgctta |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32206852 |
gattttctccaattccttcttccaaccaccaagaaaataggtgatgtattatatcagcttttcttttctgttcaaggtgaatttgatgatggcttgctta |
32206753 |
T |
 |
| Q |
201 |
aagagattaattgttgttttgtttg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32206752 |
aagagattaattgttgttttgtttg |
32206728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 4 - 70
Target Start/End: Complemental strand, 10835847 - 10835781
Alignment:
| Q |
4 |
tcaaagtttgtccctgtgaatgcttgtatccaaattgttgctattagcaccacccactttcttgatt |
70 |
Q |
| |
|
||||| ||||| |||||||||||||| ||||| |||||||||||||| | || ||| |||||||||| |
|
|
| T |
10835847 |
tcaaaatttgttcctgtgaatgcttgaatccatattgttgctattagtatcatccattttcttgatt |
10835781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University