View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_162 (Length: 239)
Name: NF20151_low_162
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_162 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 10261804 - 10261585
Alignment:
| Q |
1 |
ttgatggaaatattaaaagaatcagccgtccaaaaaactgtagaagaagttgacattagcttactgaaatgcaaggggacaaacaattaaaataatctag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10261804 |
ttgatggaaatattaaaagaatcagccgtccaaaaa-ctgtagaagaagttgacattaggttactgaaatccaaggggacaaacaattaaaataatctat |
10261706 |
T |
|
| Q |
101 |
tttatgttctaagattcaactttttcatcatttatttttgtcactgcaacacattataacactatcaaatcgagatcaatatagattgtatagtttacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |||||||||||| |
|
|
| T |
10261705 |
tttatgttctaagattcaactttttcatcctttatttttgtcactgcaacacattataacactatcaaattgagatca--atagattttatagtttacaa |
10261608 |
T |
|
| Q |
201 |
attattacataggcatggtttct |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10261607 |
attattacataggcatggtttct |
10261585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University