View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_176 (Length: 228)
Name: NF20151_low_176
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_176 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 29 - 206
Target Start/End: Original strand, 42335803 - 42335977
Alignment:
| Q |
29 |
agcttgaacctcatgtttgcatacgggatatcttttataacttataactttacacttcaagtttacatactggatatctttgggagttgttgttatgcca |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42335803 |
agcttgaacctcatgtttgcatacgggatatcttttataacttataactttacacttcaagtttacatactggatatctttggga---gttgttatgcca |
42335899 |
T |
|
| Q |
129 |
aagaaagaaaatgattgcctttgattttaagatcgtagtcatggtgacatttagcatacacggatgatagaatttgtg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42335900 |
aagaaagaaaatgattgcctttgattttaagatcgtagtcatggtgacatttagcatacacggatgatagaatttgtg |
42335977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University