View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_181 (Length: 211)
Name: NF20151_low_181
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_181 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 16 - 137
Target Start/End: Complemental strand, 44342271 - 44342149
Alignment:
| Q |
16 |
gcagagatataacaacatgggtggccgccaagttgtagggtgagtagtact-acttattcaatttctcactattcacttcatttttcacgtttcaaaaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44342271 |
gcagagatataacaacatgggtggccgccaagttgttgggtgagtagtacttactttttcaatttctcactattcacttcatttttcacgtttcaaaaat |
44342172 |
T |
|
| Q |
115 |
atttggtaggtgacatgcctcat |
137 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44342171 |
atttggtaggtgacatgcctcat |
44342149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 156 - 187
Target Start/End: Complemental strand, 44342141 - 44342110
Alignment:
| Q |
156 |
attaatatttaatcatgtctttagctcgattc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44342141 |
attaatatttaatcatgtctttagctcgattc |
44342110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University