View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_185 (Length: 206)
Name: NF20151_low_185
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_185 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 190
Target Start/End: Original strand, 5851980 - 5852156
Alignment:
| Q |
14 |
attatactgataaacaaaatatttgcacaacttagtccaagtcttcttgtgtgataattgatgaaaaatcaaaacagttttgtggtatataatctagtct |
113 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5851980 |
attatactgataaacaaaatattggcacaacttagtccaagtcttcttgtgtgataattgatgaaaaatcaaaacagttttgtggtatataatctagtct |
5852079 |
T |
|
| Q |
114 |
actcagcttaaagctttggtttgttgacaagatgtgaacggataaattgacaattagcagcaccactaaggtaatgg |
190 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5852080 |
actcagcttaaagctttggtttgttagcaagatgtgaacggataaattgacaattagcagcaccactaaggtaatgg |
5852156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University