View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_42 (Length: 432)
Name: NF20151_low_42
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 5e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 5180104 - 5180247
Alignment:
| Q |
17 |
aaaagcttatgaggagctttttgaagaggatctcatcaaacgtcttgagtcagaaatctccggtgactttgaggtatagtattcaaacattagatttgtt |
116 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5180104 |
aaaagcttatgaggagcttttcgaagaggatctcatcaaacgtcttgagtcagaaatctccggtgactttgaggtatagtattcaaacattagatttgtc |
5180203 |
T |
|
| Q |
117 |
tcctctaaattgaccaactcactttagacactaaagcgaataat |
160 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5180204 |
tccttgaaattgaccaactcactttagacactaaagcgaataat |
5180247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 301 - 427
Target Start/End: Original strand, 5180312 - 5180438
Alignment:
| Q |
301 |
ttgttattcagagggctgtgtaccggtggatgttggaccctgcagaccgtgacgctgttttgatcaatgtagcaatcaggaatggcaacaaagactatca |
400 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5180312 |
ttgttattcagagggccgtgtaccggtggatgttggaccctgcagaccgtgacgctgttttgatcaatgtagcaatcaggaatggcaataaagactatca |
5180411 |
T |
|
| Q |
401 |
tgtggttgctgaaattgcttctgtgct |
427 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5180412 |
tgtggttgctgaaattgcttctgtgct |
5180438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 19 - 93
Target Start/End: Complemental strand, 14153134 - 14153060
Alignment:
| Q |
19 |
aagcttatgaggagctttttgaagaggatctcatcaaacgtcttgagtcagaaatctccggtgactttgaggtat |
93 |
Q |
| |
|
|||||||| |||| ||| | ||||||||||||||||||| ||||| || ||| |||| ||| |||||||||||| |
|
|
| T |
14153134 |
aagcttatcaggacatttatcaagaggatctcatcaaacgccttgaatctgaactctctggtaactttgaggtat |
14153060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University