View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_82 (Length: 342)
Name: NF20151_low_82
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_82 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 20 - 331
Target Start/End: Complemental strand, 19712354 - 19712046
Alignment:
| Q |
20 |
gtcttgactacattaattgatattttgacctgataagttgattgtagtatatttgtgcagtgaatttttgctgaatgagtgaaagttgtgattgatgatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19712354 |
gtcttgactacattaattgatattttgacctgataagttgattgtagtatatgtgtgcagtgaatttttgctgaatgagtgaaagttgtgattgatgatc |
19712255 |
T |
 |
| Q |
120 |
ttgaattaaaatagacattatgaggatatatggtgttagacaatttttatgtatttttccttattaaaatgtttgtgttggctttgatttctaattttgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19712254 |
ttgaattaaaatagacattatgaggatatatggtgttagacaatttttatgtatttttccttattaaaatgtttgtgttggctttgatttctaattttgt |
19712155 |
T |
 |
| Q |
220 |
tnnnnnnnnnnnnnnntgttattaataagaatgtttgacgttgttgttttctccttagtagtgtgccatttatttatctattattttctgttttatttag |
319 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19712154 |
t---aaaaaaaaaaaatgttattaataagaatgtttgacgttgttgttttctccttagtagtgtgccatttatttctctattattttctgttttatttag |
19712058 |
T |
 |
| Q |
320 |
ttggtactctct |
331 |
Q |
| |
|
|||||||||||| |
|
|
| T |
19712057 |
ttggtactctct |
19712046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University