View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20151_low_92 (Length: 322)
Name: NF20151_low_92
Description: NF20151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20151_low_92 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 11 - 181
Target Start/End: Complemental strand, 30809129 - 30808959
Alignment:
| Q |
11 |
cacagacatagcaagcaacaactacaaagaaactcaatcaatttttccttgcctttgttgggaccttgaatttgagatgaatttaccatcatatacatga |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |||||||||| |||||||||||||||||||| |||| |
|
|
| T |
30809129 |
cacacacatagcaagcaacaactacaaagaaactcaatcaatttttccctgcctttgttaggatcttgaatttgggatgaatttaccatcatatatatga |
30809030 |
T |
|
| Q |
111 |
agaatgttgcaattgaagatgaaatacttgcaatactattcttgaaggtttgtgtaagcatttagaacatg |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30809029 |
agaatgttgcaattgaagatgaaatacttgcaatactattcttgaaggtttgtgtaagcatttagaacatg |
30808959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 253 - 305
Target Start/End: Complemental strand, 30808887 - 30808835
Alignment:
| Q |
253 |
gttatcaaggaatcttagttgttattgtaaaggatgcttttcaattcaagatt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30808887 |
gttatcaaggaatcttagttgttattgtaaaggatgcttttcaattcaagatt |
30808835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University