View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20153_high_10 (Length: 238)

Name: NF20153_high_10
Description: NF20153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20153_high_10
NF20153_high_10
[»] chr5 (1 HSPs)
chr5 (16-234)||(9186580-9186795)


Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 234
Target Start/End: Original strand, 9186580 - 9186795
Alignment:
16 acaataactgaaataaacaaaacagcttgatagcagcagattatgtttcttgaactcttctacgtaattgattttatcttcttgagcttctatctatcta 115  Q
    |||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9186580 acaataactgaaataaacaaaacagcttgatagca---gattatgtttcttgaactcttctacgtaattgattttatcttcttgagcttctatctatcta 9186676  T
116 tcacttagtacatatatgtatcaaaatttggaactttataatatacgaatatgatttgttatacgcgccgcatacttgcgtgtgaatctacgtgtcgtaa 215  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9186677 tcacttagtacttatatgtatcaaaatttggaactttataatatacgaatatgatttgttatacgcgccgcatacttgcgtgtgaatctacgtgtcgtaa 9186776  T
216 aacaaatgcctttgtttct 234  Q
    ||||||||||||| |||||    
9186777 aacaaatgcctttttttct 9186795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University