View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20153_high_10 (Length: 238)
Name: NF20153_high_10
Description: NF20153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20153_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 234
Target Start/End: Original strand, 9186580 - 9186795
Alignment:
| Q |
16 |
acaataactgaaataaacaaaacagcttgatagcagcagattatgtttcttgaactcttctacgtaattgattttatcttcttgagcttctatctatcta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9186580 |
acaataactgaaataaacaaaacagcttgatagca---gattatgtttcttgaactcttctacgtaattgattttatcttcttgagcttctatctatcta |
9186676 |
T |
 |
| Q |
116 |
tcacttagtacatatatgtatcaaaatttggaactttataatatacgaatatgatttgttatacgcgccgcatacttgcgtgtgaatctacgtgtcgtaa |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9186677 |
tcacttagtacttatatgtatcaaaatttggaactttataatatacgaatatgatttgttatacgcgccgcatacttgcgtgtgaatctacgtgtcgtaa |
9186776 |
T |
 |
| Q |
216 |
aacaaatgcctttgtttct |
234 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
9186777 |
aacaaatgcctttttttct |
9186795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University