View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20155_high_14 (Length: 220)
Name: NF20155_high_14
Description: NF20155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20155_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 204
Target Start/End: Complemental strand, 27262605 - 27262417
Alignment:
| Q |
16 |
aagaaatactgacagtnnnnnnngacaaataagtgcatgaaattttgattttgcttccaaagggggtcaagtagacactaaccatttggcgaaatgagca |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27262605 |
aagaaatactgacagtaaaaaaagacaaataagtgcatgaaattttgattttgcttccaaagggggtcaagtagacactaaccatttggcgaaatgagca |
27262506 |
T |
 |
| Q |
116 |
ccttgctggtagtatgcagctgaacgagaggcaagaccgtctagaccttggcaccatctcatcattggaaccagcaaggggcaccaaac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27262505 |
tcttgctggtagtatgcagctgaacgagaggcaagaccgtctagaccttggcaccatctcatcattggaaccagcaaggggcaccaaac |
27262417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 90 - 201
Target Start/End: Complemental strand, 21195044 - 21194931
Alignment:
| Q |
90 |
acactaaccatttggcgaaatgagcaccttgctggtagtatgcagctgaacgagaggcaagaccgtctagaccttggcaccat--ctcatcattggaacc |
187 |
Q |
| |
|
||||| |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
21195044 |
acactcaccatttggcgaaacgagcaccttgttggtagtatgcagctgaacgagaggcaagaccgtccagaccttggcaccatgattcatcgttggaacc |
21194945 |
T |
 |
| Q |
188 |
agcaaggggcacca |
201 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
21194944 |
agctaggggcacca |
21194931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 90 - 201
Target Start/End: Complemental strand, 27250817 - 27250704
Alignment:
| Q |
90 |
acactaaccatttggcgaaatgagcaccttgctggtagtatgcagctgaacgagaggcaagaccgtctagaccttggcaccat--ctcatcattggaacc |
187 |
Q |
| |
|
||||| |||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
27250817 |
acactcaccatttggcaaaacgagcaccttgttggtagtatgcagctgaacgagaggcaagaccgtccagaccttggcaccatgattcatcgttggaacc |
27250718 |
T |
 |
| Q |
188 |
agcaaggggcacca |
201 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
27250717 |
agctaggggcacca |
27250704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University