View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20155_high_4 (Length: 404)
Name: NF20155_high_4
Description: NF20155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20155_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 351 - 390
Target Start/End: Original strand, 36865425 - 36865464
Alignment:
| Q |
351 |
caatatatatgtatgtgatacatcattcaataaaaaatat |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36865425 |
caatatatatgtatgtgatacatcattcaataaaaaatat |
36865464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University