View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20155_low_14 (Length: 282)
Name: NF20155_low_14
Description: NF20155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20155_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 8 - 264
Target Start/End: Original strand, 55721885 - 55722142
Alignment:
| Q |
8 |
cgaagaatatcatgtgttcgtcgtataaaagtctttttctcttatttattactcattatgtcgcctctattgacactatattgtaacaaattcaaacatg |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55721885 |
cgaagcatatcatgtgttcgtcgtataaaagtctttttctcttatttatgactcattatgtcgcctctattgacactatattgtaacaaattcaaacatg |
55721984 |
T |
 |
| Q |
108 |
atgcggttagaaagtgtttgcagaacctggactgaaagctcaacaaaactgtcagcacgatacatcgatgatttattgtactccgaaaaccagtaacatc |
207 |
Q |
| |
|
|| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55721985 |
attcagttagaaagtgtttgcagaacctggactgaaagctcaacaaaactgtcagcacgatacatcgatgatttattgtactccgaaaaccagtaacatc |
55722084 |
T |
 |
| Q |
208 |
ccatatatgttttgctttctcacagttgat-aaaacaagagactcattaacgtcatat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
55722085 |
ccatatatgttttgctttctcacagttgataaaaacaagagactcattaatgtcatat |
55722142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University