View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20155_low_17 (Length: 235)
Name: NF20155_low_17
Description: NF20155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20155_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 2573097 - 2573318
Alignment:
| Q |
1 |
agtactgatacttaagtacttaaattattacttattagagcatgtcacatttagatatgtatacatatatgtgtgcgcgtgtgttgtgctgcatgttgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2573097 |
agtactgatacttaagtacttaaattattacttattagagcatgtcacatttagatatgtatacatatatgtgtgcgtgtgtgttgtgctgcatgttgat |
2573196 |
T |
|
| Q |
101 |
tagttttataatcaagtattgttatgattgctaggtgggagatggaaacgcggatcataattgttgggagcgtccagaagacatggatacaccaagaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2573197 |
tagttttataatcaagtattgttatgattgctaggtgggagatggaaacgcggatcataattgttgggagcgtccagaagacatggatacaccaagaaca |
2573296 |
T |
|
| Q |
201 |
acttacaagattgattcaaatt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2573297 |
acttacaagattgattcaaatt |
2573318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 113 - 215
Target Start/End: Original strand, 2563436 - 2563538
Alignment:
| Q |
113 |
caagtattgttatgattgctaggtgggagatggaaacgcggatcataattgttgggagcgtccagaagacatggatacaccaagaacaacttacaagatt |
212 |
Q |
| |
|
|||| |||||| |||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
2563436 |
caagaattgttgtgattgctaggttggagaaggaaacgctgatcataattgttgggagcgtccagaagacatggatactccaagaacactttacaagatt |
2563535 |
T |
|
| Q |
213 |
gat |
215 |
Q |
| |
|
||| |
|
|
| T |
2563536 |
gat |
2563538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University