View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20155_low_5 (Length: 404)

Name: NF20155_low_5
Description: NF20155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20155_low_5
NF20155_low_5
[»] chr2 (1 HSPs)
chr2 (351-390)||(36865425-36865464)


Alignment Details
Target: chr2 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 351 - 390
Target Start/End: Original strand, 36865425 - 36865464
Alignment:
351 caatatatatgtatgtgatacatcattcaataaaaaatat 390  Q
    ||||||||||||||||||||||||||||||||||||||||    
36865425 caatatatatgtatgtgatacatcattcaataaaaaatat 36865464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University