View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20156_high_8 (Length: 266)

Name: NF20156_high_8
Description: NF20156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20156_high_8
NF20156_high_8
[»] chr1 (1 HSPs)
chr1 (37-247)||(14347563-14347773)


Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 37 - 247
Target Start/End: Original strand, 14347563 - 14347773
Alignment:
37 agaaaacacgaacataattcatatggttgtagacgaacatgttctaatgcatgcacgagcatgtgaaatatttataacatgaattcatttagaaaatgtg 136  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14347563 agaaaacacaaacataattcatatggttgtagacgaacatgttctaatgcatgcacgagcatgtgaaatatttataacatgaattcatttagaaaatgtg 14347662  T
137 aatagatgatgtcatatccatattaatcctaagatggcatgtacaaatgcatagacatatacttggcacttagatatttagcatgttaagcaattagaaa 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14347663 aatagatgatgtcatatccatattaatcctaagatggcatgtacaaatgcatagacatatacttggcacttagatatttagcatgttaagcaattagaaa 14347762  T
237 catgtacgtga 247  Q
    |||||||||||    
14347763 catgtacgtga 14347773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University