View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20157_high_13 (Length: 211)
Name: NF20157_high_13
Description: NF20157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20157_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 13 - 193
Target Start/End: Complemental strand, 27507024 - 27506840
Alignment:
| Q |
13 |
ataattctcaatcctcttttcacgtcttttctattcaaccccacaccattctagcactcccaatgggtaatcaaatttgagggagtaataa---acacct |
109 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
27507024 |
ataattctcaatcctcttttcacttcttttctattcaaccccacaccattccagcactcccaatgggtaaacagatttgagggagtaataacagacacct |
27506925 |
T |
 |
| Q |
110 |
ctaaccattcttgaacattttgcccaattttcgaagtctcattgcaatgcaaaaataagtggtttgtag-ctcattctgctcatt |
193 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27506924 |
ctaaccattcttgaacatattgccaaattttccaagtctcattgcaatgcaaaaataagtggtttgtagactcattctgctcatt |
27506840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University