View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20157_high_6 (Length: 308)
Name: NF20157_high_6
Description: NF20157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20157_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 21 - 295
Target Start/End: Original strand, 23358256 - 23358530
Alignment:
| Q |
21 |
atcctagtgatacaattcttccaggaatgaagcttggttggaaccttgcgagcggtcttaataggcaactaacagcttggaagaattgggatgacccttc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23358256 |
atcctagtgatacaattcttccaggaatgaagcttggttggaaccttacgagcggtcttaataggcaactaacagcttggaagaattgggatgacccttc |
23358355 |
T |
|
| Q |
121 |
ttcgggtcaaacgacttatggctacataagaagtgacaatcctgaatcggagataaggaatggttcgtcgatgatatacagaagtggacctttcaatggt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23358356 |
ttcgggtcaaacgacttatggctacataagaagtgacaatcctgaatcggagataaggaatggttcgtcgatgatatacagaagtggacctttcaatggt |
23358455 |
T |
|
| Q |
221 |
attcgtttcgctgctacacaaaaattgaaacatgttccattattcaacgtcgattttgtgtacaaaaaggatgag |
295 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23358456 |
attcgtttcgctgctacacaaaaattaaaacatgttccattattcaacgtcgattttgtgtacaaaaaggatgag |
23358530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University