View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20157_high_8 (Length: 263)
Name: NF20157_high_8
Description: NF20157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20157_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 2 - 247
Target Start/End: Original strand, 13653261 - 13653506
Alignment:
| Q |
2 |
attttatattttatttaaggtactaagtaagtactgaatcaataaccctgtcaatctttagataggaaattggttcaactaattatgaaattgaaaatgt |
101 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13653261 |
attttttattttatttaaggtattaagtaagtactgaatcaataaccctgtcaatctttagataggaaattggttcaactaattatgaaattgaaaatgg |
13653360 |
T |
 |
| Q |
102 |
gatgtctatcaattggcttcaccttgtcattctccaagtaaggtctcattttgtctaagtttatgtttggtatcatggtgggttgtcaaaatgtcacttg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13653361 |
gatgtctatcaattggcttcaccttgtcattctccaagtaaggtctcattttgtctaaatttatgtttggtatcatggtgggttgtcaaaatatcacttg |
13653460 |
T |
 |
| Q |
202 |
ttagaatcatgggttaaaccaataacaaaagctttgttgaacattt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13653461 |
ttagaatcatgggttaaaccaataacaaaggctttgttgaacattt |
13653506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University