View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20157_low_7 (Length: 295)
Name: NF20157_low_7
Description: NF20157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20157_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 277
Target Start/End: Original strand, 39507842 - 39508109
Alignment:
| Q |
10 |
aagaatattgagggcctggcttagatgaaaattttacaagattctattttccttacattaaattcggagtgtgctccactctatgtcttacattcgattg |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39507842 |
aagaaaattgagggcctggcttagatgaaaattttacaagattctattttccttactttaaattcggagtgtgctccactctatgtcttacattcgattg |
39507941 |
T |
 |
| Q |
110 |
atactaacaattcttatgttgtgtcggtttatacaaggttttgtcttgacttcaattgcgtcccccctaatggatggtgggattggtcctccggattagt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39507942 |
atactaacaattcttatgttgtgtcggtctatataaggttttgtcttgacttcaattacgtcccccctaatggatggtgggattggtcctccaaattagt |
39508041 |
T |
 |
| Q |
210 |
cggtctttaagctaaataccgacttttcgaagnnnnnnnntcaaaactaactcctctcaagtattatt |
277 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
39508042 |
cggtctttaagctaaataccgattttttgaagaaaaaaaatcaaaactaactcctctcaagtattatt |
39508109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 171 - 214
Target Start/End: Original strand, 37056528 - 37056571
Alignment:
| Q |
171 |
cccccctaatggatggtgggattggtcctccggattagtcggtc |
214 |
Q |
| |
|
|||| ||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
37056528 |
ccccgctagtggacggtgggattggtcctccggattagtcggtc |
37056571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 159 - 217
Target Start/End: Complemental strand, 28409303 - 28409245
Alignment:
| Q |
159 |
cttcaattgcgtcccccctaatggatggtgggattggtcctccggattagtcggtcttt |
217 |
Q |
| |
|
||||||||| | |||| ||| |||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
28409303 |
cttcaattgggcccccactagtggacggtgggattggtcccccgaattagtcggtcttt |
28409245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 180 - 214
Target Start/End: Original strand, 43504749 - 43504783
Alignment:
| Q |
180 |
tggatggtgggattggtcctccggattagtcggtc |
214 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43504749 |
tggatggtgggattggtcccccggattagtcggtc |
43504783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 115 - 167
Target Start/End: Original strand, 37565284 - 37565336
Alignment:
| Q |
115 |
aacaattcttatgttgtgtcggtttatacaaggttttgtcttgacttcaattg |
167 |
Q |
| |
|
|||||||| ||||||| ||||||| |||||||||||||| ||||||||||| |
|
|
| T |
37565284 |
aacaattcatatgttgggtcggttaatacaaggttttgttccgacttcaattg |
37565336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 182 - 214
Target Start/End: Original strand, 28090642 - 28090674
Alignment:
| Q |
182 |
gatggtgggattggtcctccggattagtcggtc |
214 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
28090642 |
gatggtgggattggtcccccggattagtcggtc |
28090674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University