View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20158_high_22 (Length: 213)
Name: NF20158_high_22
Description: NF20158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20158_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 15 - 170
Target Start/End: Complemental strand, 27250287 - 27250132
Alignment:
| Q |
15 |
cagagatatagtctccaagagatggaactgtcacaagaagggtacgccatgcttgacggttagcttcagtgttttctagcccaattgaagccaaacgctt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27250287 |
cagagatatagtctccaagagatggaactgtcacaagaagggtacgccatgcttggcggttagcttcagtgttttctagcccaattgaagccaaacgctt |
27250188 |
T |
 |
| Q |
115 |
tccacatgtagcattggattcatccatggctaaaataccacgccctggtgaagcaa |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27250187 |
tccacatgtagcattggattcatccatggctaaaataccacgccctggtgaagcaa |
27250132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 15 - 170
Target Start/End: Complemental strand, 21194514 - 21194359
Alignment:
| Q |
15 |
cagagatatagtctccaagagatggaactgtcacaagaagggtacgccatgcttgacggttagcttcagtgttttctagcccaattgaagccaaacgctt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21194514 |
cagagatatagtctccaagagatggaactgtcacaagaagggtacgccatgcttggcggttagcttcagtgttttctagcccaattgaagccaaacgctt |
21194415 |
T |
 |
| Q |
115 |
tccacatgtagcattggattcatccatggctaaaataccacgccctggtgaagcaa |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21194414 |
tccacatgtagcattggattcatccatggctaaaattccacgccctggtgaagcaa |
21194359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 15 - 170
Target Start/End: Complemental strand, 27262116 - 27261961
Alignment:
| Q |
15 |
cagagatatagtctccaagagatggaactgtcacaagaagggtacgccatgcttgacggttagcttcagtgttttctagcccaattgaagccaaacgctt |
114 |
Q |
| |
|
||||||| || ||||||||||||||||||||||| ||||| |||||||||||| | |||||| |||| ||||| |||||||||||||||||||||| || |
|
|
| T |
27262116 |
cagagatgtactctccaagagatggaactgtcaccagaagagtacgccatgctgggcggttaacttcggtgttctctagcccaattgaagccaaactttt |
27262017 |
T |
 |
| Q |
115 |
tccacatgtagcattggattcatccatggctaaaataccacgccctggtgaagcaa |
170 |
Q |
| |
|
||||| ||||||||||| ||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
27262016 |
cccacaagtagcattggactcatccatggccaaaataccacgtcctggtgaagcaa |
27261961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University