View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20158_high_5 (Length: 364)
Name: NF20158_high_5
Description: NF20158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20158_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 91 - 307
Target Start/End: Original strand, 47458144 - 47458356
Alignment:
| Q |
91 |
gatgaatttgatttttacatgttgttacgaaaaaacaaaagattttgtgattcgggaaaacggtaaaggtaaaacctggtagcataacccaagtgacttt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47458144 |
gatgaatttgatttttacatgttgttacgaaaaaacaaaagattttgtgattcgggaaaacggtaaaggtaaaacctggtagcataacctaagtgacttt |
47458243 |
T |
 |
| Q |
191 |
agaagcagaagcatttgtatacggtgaaccaacccatcccaaaaactgtgttcatagttctgatcggtgttcagcttccattaacgattctgattacgaa |
290 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47458244 |
agaagcagaagcatttgtatacggtg----aacccatcccaaaaactgtgttcatagttctgatcggtgttcagcttccattaacgattctgattacgaa |
47458339 |
T |
 |
| Q |
291 |
aatgtcgaatcgtttcg |
307 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
47458340 |
aatgtcgaatcgtttcg |
47458356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University