View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20158_high_8 (Length: 354)
Name: NF20158_high_8
Description: NF20158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20158_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 12 - 336
Target Start/End: Original strand, 38932520 - 38932848
Alignment:
| Q |
12 |
cagagacaccaacacaacgtagctcagggtgattagcatcccatgtttcagtcagacctgcttctgactcaatgcggttgtcaggttccaatgcatcgat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38932520 |
cagagacaccaacacaacgtagctcagggtgattagcatcccatgtttcagtcagacctgcttctgactcaatgctgttgtcaggttccaatgcatcgat |
38932619 |
T |
|
| Q |
112 |
gctatctagttggcacgactcaatttgatgacgtggtggaagctgtcgtgctgaacataagaagagtaacaaacaaagtgtgatcagaagagattttgtc |
211 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932620 |
gctatctagttggcacgactcactttgatgacgtggtggaagctgtcgtgctgaacagaagaagagtaacaaacaaagtgtgatcagaagagattttgtc |
38932719 |
T |
|
| Q |
212 |
tttgccatgatagctg---aactgtggagattgttatgtagtga-tttatttatagaaatgtagagaaggttaaacgatggacacgtaagtgaagcaatg |
307 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932720 |
tttgccatgctagctgaacaactgtggagattgttatgtagttattttatttatagaaatgtagagaaggttaaacgatggacacgtaagtgaagcaatg |
38932819 |
T |
|
| Q |
308 |
tggacattcttcaccatgcatgcatatca |
336 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38932820 |
tggacattcttcaccatgcatgcatatca |
38932848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University