View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20158_low_13 (Length: 342)
Name: NF20158_low_13
Description: NF20158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20158_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 17 - 325
Target Start/End: Complemental strand, 11350121 - 11349813
Alignment:
| Q |
17 |
agttaacacacatgcctcccttattattagatttcttgcctaatacaacatttgagaacaaagtagtatattatgctctcaattataaatcgagctttaa |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
11350121 |
agttaacacacatgcctcacttattattagatttcttgcctaatacaacatttgagaaccaagtagtatattatgctctcaattacaaatcgacctttaa |
11350022 |
T |
 |
| Q |
117 |
gagacccgagacaacttttatagctacttcaactttctatggtgactacttcttccttttctgaaccacataggcgggtcagcttgttgacgaccaaaat |
216 |
Q |
| |
|
||| |||||||||||||||||| || ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11350021 |
gaggcccgagacaacttttataactgcttcaactttctaaggtgactgcttcttccttttctgaaccacataggcgggtcagcttgttgacgaccaaaat |
11349922 |
T |
 |
| Q |
217 |
gtggcaggccagctcaagatctattgttggcatctcatcaacaccccacgcaaacgtatcagcgttggcctggaggcgtttggatggttcagggctctgt |
316 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11349921 |
gtggcaggccagctcaagatttattcttggcatctcatcaacagcccacgcaaacgtatcagcgttggcctggaggcatttggatggttcagggctctgt |
11349822 |
T |
 |
| Q |
317 |
aacttcttt |
325 |
Q |
| |
|
||||||||| |
|
|
| T |
11349821 |
aacttcttt |
11349813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University