View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20158_low_20 (Length: 251)
Name: NF20158_low_20
Description: NF20158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20158_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 13 - 151
Target Start/End: Complemental strand, 6710471 - 6710333
Alignment:
| Q |
13 |
aaaattatgacagaaataaaaggaattcataagaaaagtaaagaacgacaatcagatgaaaaaagtaatttggaggaatactagtttttaaggagcctga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6710471 |
aaaattatgacagaaataaaaggaattcataagaaaagtaaagagcgacaatcagatgaaaaaagtaatttggaggaatactagtttttaaggagcctga |
6710372 |
T |
|
| Q |
113 |
atagttgtcacaattcacaaaggtgcaataacattcgtg |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6710371 |
atagttgtcacaattcacaaaggtgcaataacattcgtg |
6710333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 174 - 251
Target Start/End: Complemental strand, 6710307 - 6710230
Alignment:
| Q |
174 |
ttataaggtaaaaactactcgaccacggcacaccaatcgcagtaaaatatgtaaagcacagaactcaaacaacagaaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6710307 |
ttataaggtaaaaactactcgaccacggcacaccaatcgcagtaaaatatgtaaagcacagaactcaaacaacagaaa |
6710230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University