View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20158_low_23 (Length: 242)
Name: NF20158_low_23
Description: NF20158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20158_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 7843317 - 7843108
Alignment:
| Q |
14 |
cacagacacaatgaaatctgcagcatccggtacattctttgccattactgatcttatatatactcattcatgcaccactcaattttttgtgagagaattt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7843317 |
cacagacacaatgaaatctgcagcatccggtacattctttgccattactgatcttatatatactcattcatgcaccactcaattttttgtgagagaattt |
7843218 |
T |
 |
| Q |
114 |
ccaaaatatgtttggaatgttgcaaaagttaaatgaattaactaaattattttgattcaatgtattgtttggttagttgttgcgatttgtgtagatgtag |
213 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7843217 |
ccagaatatgtttggaatgttgcaaaagttaaatgaattaactaaattattttgattcaatgtattgtttggttagttgttgcgatttgtgtagatgtag |
7843118 |
T |
 |
| Q |
214 |
gtttgaatac |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
7843117 |
gtttgaatac |
7843108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University