View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20159_high_19 (Length: 270)
Name: NF20159_high_19
Description: NF20159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20159_high_19 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 270
Target Start/End: Complemental strand, 45683715 - 45683460
Alignment:
| Q |
18 |
atagaaagtttgagggaattaatatcattgaaccgaacaaaatggaaatatgaaaaacattttattttggttgatagctaacccaaatttaaacaccaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45683715 |
atagaaagtttgagggaattaatatcattgaaccgaacaaaatggaaatatgaaaaacattttattttggttgatagctaacccaaatttaaacaccaac |
45683616 |
T |
 |
| Q |
118 |
acgcaaggctacaacctaacaac---tttattaatatcaatgaggttatagtgttgtgtcaagttactctgattgtatgcaattatatatcagtacctaa |
214 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45683615 |
acgcaaggctacaacctaacaacaactttattaatatcaatgaggttatagtgttgtgtcaagttactctgattgtaagcaattatatatcagtacctaa |
45683516 |
T |
 |
| Q |
215 |
aatatagcaactgatagcagttcataatattttcagcacttttctaaatgtgtaat |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45683515 |
aatatagcaactgatagcagttcataatattttcagcacttttctaaatgtgtaat |
45683460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University