View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20159_high_21 (Length: 258)

Name: NF20159_high_21
Description: NF20159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20159_high_21
NF20159_high_21
[»] chr3 (1 HSPs)
chr3 (112-240)||(3645084-3645215)


Alignment Details
Target: chr3 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 112 - 240
Target Start/End: Original strand, 3645084 - 3645215
Alignment:
112 ttataacatgattgttattgcattgggaattatcgtagacgtgttttcaatacaaagctacactttgtaccttctattattcattgtgattggtgaaaac 211  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3645084 ttatatcatgattgttattgcattgggaattatcgtagacgtgttttcaatacaaagctacactttgtaccttctattattcattgtgattggtgaaaac 3645183  T
212 gatctcataac---atgataatcgcaagtttg 240  Q
    |||||||||||   ||||||||||||||||||    
3645184 gatctcataacatgatgataatcgcaagtttg 3645215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University