View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20159_high_28 (Length: 234)
Name: NF20159_high_28
Description: NF20159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20159_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 142 - 195
Target Start/End: Original strand, 28990417 - 28990470
Alignment:
| Q |
142 |
ataatgtggtctctgttgaaacccagcgttcgcattgttcgggtttgagttcaa |
195 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28990417 |
ataatgtggtctctgttgaaacccggcgttcgcattgttcgggtttgagttcaa |
28990470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 142 - 195
Target Start/End: Original strand, 29000874 - 29000927
Alignment:
| Q |
142 |
ataatgtggtctctgttgaaacccagcgttcgcattgttcgggtttgagttcaa |
195 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
29000874 |
ataatgtggtctctgttgaaacccggcgtttgcattgttcgggtttgagttcaa |
29000927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University