View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20159_low_24 (Length: 239)
Name: NF20159_low_24
Description: NF20159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20159_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 48 - 224
Target Start/End: Original strand, 31477658 - 31477834
Alignment:
| Q |
48 |
cctccgataattatttactcgatcttatgtaattactcaaatttaaatgtgactacctgccatctccaacgatcaaatggctttgcaccagtatatttat |
147 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31477658 |
cctccgataattatttactcgatcttatataattactcaaatttcaatgtgactacctgccatctccaacgatcaaatggctttgcaccagtatatttat |
31477757 |
T |
|
| Q |
148 |
ctggattaacattgcattttttgtttccatagctagctaccatacctccatatatcctactgaggatatcatctcca |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31477758 |
ctggattaacattgcattttttgtttccatagctagcaaccatacctccatatatcctactgaggatatcatctcca |
31477834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University